ligD [2019-02-28 16:22:56]

DNA repair polymerase/ ligase in non-homologous end joining DNA repair

locus: BSU13400

pI: 6.65

mw: 70.03 kDa

protein length: 611 aa

gene length: 1836 bp

function: non-homologous end joining DNA repair, repair of gapped DNA substrates

product: DNA repair polymerase/ ligase

essential: no

synonyms: ykoU

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.3|Spore-encoded non-homologous end joining system]
• [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]

Gene

Coordinates: 1,404,518 1,406,353

Phenotypes of a mutant

• sensitivity to ionizing radiation in the stationary phase [Pubmed|12215643]
• sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]
• a ''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]'' double mutant is sensitive to radiation [Pubmed|24123749]

The protein

Catalyzed reaction/ biological activity

• has inherent polymerization and ligase activities that allow it to fill the short gaps that can arise after realignment of the broken ends and to seal the resulting nicks, contributing to genome stability during the stationary phase and germination
• has an intrinsic 5'-2-deoxyribose-5-phosphate (dRP) lyase activity located at the N-terminal ligase domain [Pubmed|26826709]

[SW|Domains]

• N-terminal DNA ligase catalytic domain (aa 1 - 331) linked to a C-terminal polymerase domain (aa 332 - 611) [Pubmed|23691176]

Expression and Regulation

Operons

• genes: [gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]
  description: [Pubmed|16497325]

  sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]

  regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|16497325], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]

  regulation

  • expressed during sporulation in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|16497325]

Biological materials

Mutant

• MGNA-A778 (ykoU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/778 NBRP B. subtilis, Japan]
• BP141 (''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [SW|Fabian Commichau]'s lab
• BP142 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]-[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [SW|Fabian Commichau]'s lab
• BKE13400 ([gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT
• BKK13400 ([gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA, downstream forward: _UP4_TGACTAATGAAGTCAGCTCT

References

Reviews

• 17938628,22933559

Original publications

• 16497325,23691176,12215643,11075926,11566200,17293412,24123749,24123749,25355514,26826709,26961308,15778718,16518468,29234047